# coding=utf-8
# Open Reading Frames
# ===================
#
# Either strand of a DNA double helix can serve as the coding strand for RNA
# transcription. Hence, a given DNA string implies six total reading frames, or
# ways in which the same region of DNA can be translated into amino acids: three
# reading frames result from reading the string itself, whereas three more
# result from reading its reverse complement.
#
# An open reading frame (ORF) is one which starts from the start codon and ends
# by stop codon, without any other stop codons in between. Thus, a candidate
# protein string is derived by translating an open reading frame into amino
# acids until a stop codon is reached.
#
# Given: A DNA string s of length at most 1 kbp.
#
# Return: Every distinct candidate protein string that can be translated from
# ORFs of s. Strings can be returned in any order.
#
# Sample Dataset
# --------------
# AGCCATGTAGCTAACTCAGGTTACATGGGGATGACCCCGCGACTTGGATTAGAGTCTCTTTTGGAATAAGCCTGAATGATCCGAGTAGCATCTCAG
#
# Sample Output
# -------------
# MLLGSFRLIPKETLIQVAGSSPCNLS
# M
# MGMTPRLGLESLLE
# MTPRLGLESLLE
DNA_CODON_TABLE = {
'TTT': 'F', 'CTT': 'L', 'ATT': 'I', 'GTT': 'V',
'TTC': 'F', 'CTC': 'L', 'ATC': 'I', 'GTC': 'V',
'TTA': 'L', 'CTA': 'L', 'ATA': 'I', 'GTA': 'V',
'TTG': 'L', 'CTG': 'L', 'ATG': 'M', 'GTG': 'V',
'TCT': 'S', 'CCT': 'P', 'ACT': 'T', 'GCT': 'A',
'TCC': 'S', 'CCC': 'P', 'ACC': 'T', 'GCC': 'A',
'TCA': 'S', 'CCA': 'P', 'ACA': 'T', 'GCA': 'A',
'TCG': 'S', 'CCG': 'P', 'ACG': 'T', 'GCG': 'A',
'TAT': 'Y', 'CAT': 'H', 'AAT': 'N', 'GAT': 'D',
'TAC': 'Y', 'CAC': 'H', 'AAC': 'N', 'GAC': 'D',
'TAA': 'Stop', 'CAA': 'Q', 'AAA': 'K', 'GAA': 'E',
'TAG': 'Stop', 'CAG': 'Q', 'AAG': 'K', 'GAG': 'E',
'TGT': 'C', 'CGT': 'R', 'AGT': 'S', 'GGT': 'G',
'TGC': 'C', 'CGC': 'R', 'AGC': 'S', 'GGC': 'G',
'TGA': 'Stop', 'CGA': 'R', 'AGA': 'R', 'GGA': 'G',
'TGG': 'W', 'CGG': 'R', 'AGG': 'R', 'GGG': 'G'
}
def translate_codon(codon):
protein = None
if len(codon) == 3 and DNA_CODON_TABLE.has_key(codon):
protein = DNA_CODON_TABLE[codon]
return protein
def reverse_complement(dna):
lookup = {'A':'T', 'T':'A', 'G':'C', 'C':'G'}
return ''.join([lookup[c] for c in reversed(dna)])
def possible_protein_strings(s):
results = []
indices = []
l = len(s)
for i in range(l):
protein = translate_codon(s[i:i+3])
if protein and protein == 'M':
indices.append(i)
for i in indices:
found_stop = False
protein_string = ''
for j in range(i, l, 3):
protein = translate_codon(s[j:j+3])
if not protein:
break
if protein == 'Stop':
found_stop = True
break
protein_string += protein
if found_stop:
results.append(protein_string)
return results
if __name__ == "__main__":
small_dataset = "AGCCATGTAGCTAACTCAGGTTACATGGGGATGACCCCGCGACTTGGATTAGAGTCTCTTTTGGAATAAGCCTGAATGATCCGAGTAGCATCTCAG"
possible_a = possible_protein_strings(small_dataset)
possible_b = possible_protein_strings(reverse_complement(small_dataset))
print "\n".join(set(possible_a + possible_b))